Repeated DNA Sequences

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",

Return:
["AAAAACCCCC", "CCCCCAAAAA"].

public class Solution {
    public List<String> findRepeatedDnaSequences(String s) {
    	List<String> res = new ArrayList<>();
    	HashMap<Integer,Integer> hashMap = new HashMap<>();
    	int sum = 0;
    	for (int i = 0; i < s.length(); i++) {
			sum = ((sum << 3) | (s.charAt(i) & 7)) & 0x3FFFFFFF;  
			if (i < 9) {
				continue;
			}
			Integer integer = hashMap.get(sum);
			if (integer != null && integer == 1) {
				res.add(s.substring(i-9, i+1));
			}
			hashMap.put(sum, integer != null ? integer+1 : 1);
		}
    	return res;
    }
}