Project Six: Cloning

Java Python Project Six: Cloning (26 points)

In this two-part project you will explore the basic principles of cloning including primer design and finding compatible restriction enzyme sites between a cloning vector and an insert. These are widely used techniques in molecular biology labs.

Learning goals:

~Explain what cloning is and how it is done 

~Gain more practice designing primers

Please view the following videos to answer the first five questions before class:

DNA cloning and recombinant DNA

Primer design

I. Questions based on the introductory videos: (1 pt each; 4 total) + Quiz (5 pts)

1.  What is the ideal length of a primer (give a range)?

18-24 Nucleotides

2.  What is the maximum recommended difference in melting temperature between two primers?

5 degree celsius

3.  What is a “GC anchor”?

A GC anchor refers to the presence of guanine (G) or cytosine  bases at the 3' end of a PCR primer. Including these bases can improve the specificity and stability of the primer binding to the DNA template because G and C bases form. stronger hydrogen bonds compared to adenine (A) and thymine (T) bases

4.  How are bacteria prompted to take up a plasmid?

A heat shock is used to place the plasmid inside the body of the bacteria.

II. The role of mRNA and cDNA in cloning (10 pts)

Navigate to the NCBI website and use the search bar to locate the record for the human CFTR gene. As you did in Project One, part III, scroll down the page to the “NCBI Reference Sequences (RefSeq)” section. Look at the “mRNA and protein(s)” subsection. Recall that in the NCBI databases, specifically RefSeq, accession numbers that start with 'NM' refer to mRNA, and those starting with 'NP' refer to proteins.

Find the link to the CFTR mRNA record.

5. What is the accession number for the CFTR mRNA record?(1 pt)

NM_000492.4

6.  Which disease is a mutation version of this sequence associated with? (1 pt)

Cystic fibrosis

Notice that the sequence is written in DNA code, not RNA. This is typical. The information contained in the sequence is exactly the same as the DNA sequence. Furthermore, when mRNA is isolated from cells in the lab, we use the enzyme reverse transcriptase to convert it first into a strand of DNA complementary to the mRNA, then make the second DNA strand off of that, to make double-stranded DNA. DNA that has been transcribed from RNA is called cDNA. The "c" is for "complementary", but we just say "see DNA" so as not to confuse it with complementary DNA in the more general sense.

In the case of eukaryotic genes, the dsDNA will look exactly like the genomic DNA for the gene, except that it is missing the introns.  For cloning you use a cDNA version of the processed mRNA sequence so that the sequence will fit into the cloning vector (introns take up a lot of space!) and because splicing occurs in the nucleus, but your plasmid will be introduced into the cytoplasm.

On the left side of the GenBank record are the feature links. Clicking them highlights various regions of the sequence, such as specific exons.  Try clicking on "CDS", for "coding sequence". Notice that the transcript. has upstream and downstream sequence that is not translated (5'UTR, 3'UTR; UTR=untranslated region). Also notice that a box with more details pops up from the bottom of the page. If it's not there or you want to hide it, use the little up/down arrow next to "details".

7. How many nt in length is the coding sequence? (1 pt)

CCDS=4443

8.  What is the sequence of the start codon and its position for this transcript? (2 pts)

ATG position is 70-73

9.  What is the sequence of the stop codon and its position? (2 pts)

TAG position is 4510-4513

Find the feature link that corresponds to exon 10. To verify that it's the correct exon, make sure in include within it the sequence from the figure below question 12.

10.  Copy and paste the CFTR mRNA sequence for exon 10 below, in FASTA format (meaning, add a line that starts with the '>' symbol followed by a name). Give it a name that identifies it as wild-type (1 pt):

>Exon 10 [Organism = CFTR], Wild Type

acttcact tctaatggtg attatgggag aactggagcc

1501 ttcagagggt aaaattaagc acagtggaag aatttcattc tgttctcagt tttcctggat

1561 tatgcctggc accattaaag aaaatatcat ctttggtgtt tcctatgatg aatatagata

1621 cagaagcgtc atcaaagcat gccaactaga agag

Project Six: Cloning The most common mutation associated with this disease is a 3-bp deletion (CTT) affecting a codon in the tenth exon, resulting in the deletion of a phenylalanine (F).

11.  Make a copy of the wild-type exon 10 sequence, but edit it to reflect the mutant version, clearing indicating where the mutation is. Make sure this sequence is also in FASTA format, and give it a name that identifies it as the mutant sequence. Paste below (1 pt):

>Exon 10 [Organism = CFTR], Mutant

ACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAGCA

CAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGA

AAATATCATCTTTGGTGTTTCCTATGATGAATATAGA

TACAGAAGCGTCATCAAAGCATGCCAATTAGAAGAG#

Mutation: c to T deletion at position 1491 - 1466

12.  At what positions does exon 10 begin and end in the sequence? (1 pt)

1463..1654

In the next part you'll use the full CFTR mRNA sequence to design primers to amplify the gene sequence from cells from someone without the mutation and someone with the mutation. Then you can clone the mutant and wild-type DNA separately into cells in culture that will express each of the proteins so that you can do experiments comparing them.

III. Cloning plasmids (5 pts)

Cloning plasmids have been engineered to allow you to insert a gene sequence into the plasmid, then replicate the plasmid in bacteria. Some of these plasmids can also be introduced into mammalian cells (in culture) where the gene you inserted can be expressed. Such plasmids are known as mammalian expression plasmids, and this is the type of plasmid you will use.

The expression vector that you want to clone your gene into is called pFLAG-CMV-1. Plasmid vectors have what are called multiple cloning sites (MCSs): short stretches that have been designed to have many different restriction enzyme (RE) recognition sites, like multiple adaptors that can fit a wide range of possible inserts.

Look at the vector map (click on the pFLAG link above, and scroll down to the circular diagram). Mouse over the blue box representing the multiple cloning site.

13. What is the nucleotide position range of the MCS (mouse over it to see)? (For example, the SV40 site starts at position 1886 and ends at position 2021.)(1 pt)

991 - 1057

Now you'll want to see if the CFTR mRNA sequence happens to have any restriction enzyme (RE) sites that match in the upstream/downstream region from the coding sequence.

Copy and paste the full CFTR mRNA sequence into the NEB cutter site. Leave settings at default parameters and hit submit.

14. List two enzymes that cut upstream of the open reading frame. (represented by the first long gray arrow along the top of the linear map) and two that cut downstream. (4 pts):

Upstream - Aval and BsoBI

Downstream - BaeGI and BsaXI

IV. Primer Design (2 pts)

Since none of the RE cut sites match between the CFTR mRNA sequence and the plasmid vector (pFLAG-CMV-1), we'll design each primer to include the cut site we want at the 5' end. The extra nucleotides that make up the cut site will not hybridize to the template, but they'll be copied in the newly synthesized strands. After PCR, our amplicons will then include: RE cut site + primer sequence + sequence-of-interest + primer sequence + RE cut site. This type of PCR strategy is common, letting us add various useful motifs adjacent to the sequence-of-interest during amplification.

We'll use the same "Pick Primers" feature that we used in the previous Project to choose primers.

● Start at the NCBI GenBank record of the CFTR mRNA.

● On the right-hand side of the webpage select the “pick primers” link.

● On the primer page, specify that the minimum product size be 5000 bp, maximum 6000 bp.

● Leave everything else as default and hit "Get Primers" at the bottom of the page.

It might take a while to compute so be patient. The results will be displayed as a graphical summary and also detailed primer reports. Use the detailed primer reports to answer the next question.

 

15.  Referring back to questions 8 and 9, choose a primer pair whose product comes closest to including the coding region (start codon to stop 33333333codon). Screenshot the "Primer report" section for only that primer pair. (1 pt)

16