构建6元DNA纳米管的脚本

#this script is used to construct the six helix DNA
#the chain is construct from the bottom to the up acoording the paper
#The first chain 5'->3'
set AutoAd on
set AutoResize on
generate d d b ccacgttggtttactcactattgtcaccttataccacaatcagatccgctcaaccgatgcctagatcggc
write pdb /usr/Namot/helix1
nick 1:2:14
nick 1:3:28
nick 1:4:14
write pdb /usr/Namot/helix1-cut
close
#the second chain 5'->3' which need to rotate 180 degree when link
generate d d b aacatgaatttggctgagtttggcaagctgcaacaatgactgagcagtccgtgtgtggactatatgacac
write pdb /usr/Namot/helix2
nick 1:2:28
nick 1:3:14
write pdb /usr/Namot/helix2-cut
close
#the third chain 5'->3'
generate d d b atcaatcgtgttagacatgacgtagacggtaagtctgcgacgatgtacttattacctaccatctgcattc
write pdb /usr/Namot/helix3
nick 1:2:14
nick 1:3:14
nick 1:4:28
write pdb /usr/Namot/helix3-cut
close
#the forth chain 5'->3' which need to rotate 180 degree when link
generate d d b aagccataactccgagtcgagtgaactgtaacgtacaggtagatagactctgtatctcggtatgtcagct
write pdb /usr/Namot/helix4
nick 1:2:14
nick 1:3:14
nick 1:4:28
write pdb /usr/Namot/helix4-cut
close
#the fifth chain 5'->3'
generate d d b acattgcatcacgacttgataacgaatcttacgacgcagtagagcgagcctaatatcagtatagatgacc
write pdb /usr/Namot/helix5
nick 1:2:28
nick 1:3:14
write pdb /usr/Namot/helix5-cut
close
#the sixth chain 5'->3' which need to rotate 180 degree when link
generate d d b agcagcaattatcctgcaagtgctacactgtgcgtatgcgaatatggacgagctagaacttgcgatatgc
write pdb /usr/Namot/helix6
nick 1:2:14
nick 1:3:28
nick 1:4:14
write pdb /usr/Namot/helix6-cut
close
#load the six helix cut pdb according to the sequence
#load the helix1-cut pdb
load pdb na /usr/Namot/helix1-cut
#load the helix2-cut pdb first need to rotate 180 degree to align the two helixs
load pdb na /usr/Namot/helix2-cut
set color m1:1:*:* blue
set color m2:1:*:* green
rotate 2 1 180
trans 2  0 20 0
rotate 2 3 102
rotate 1 3 68
rotate 1 3 20
rotate 2 3 -15
trans 2 0 -1 0
rotate 2 3 -34
link 2:2:28 1:4:1
link 1:3:28 2:3:1
link 2:3:28 1:2:1
nick 1:2:10
#load the helix3-cut pdb
load pdb na /usr/Namot/helix3-cut
set color m2:1:*:* red
set color m3:1:*:* yellow
trans 3 16.45  28.5 0
rotate 3 3 60
rotate 3 3 20
link 3:3:14 2:3:1
link 1:3:32 3:4:1
link 3:4:14 2:2:1
nick 1:3:53
#load the helix4-cut pdb which need to rotate 180 degree
load pdb na /usr/Namot/helix4-cut
set color m4:1:*:* white
set color m3:1:*:* red
rotate 4 1 180
trans 4  33.77 19.5 0
rotate 4 3 34
link 4:2:14 3:4:1
link 1:4:7 4:3:1
link 4:3:28 3:3:1
link 3:2:14 4:4:1
nick 4:3:21
#load the helix5-cut pdb
load pdb na /usr/Namot/helix5-cut
set color m5:1:*:* red
set color m4:1:*:* yellow
trans 5 33.77 0 0
rotate 5 3 102
rotate 5 3 6
link 3:2:28 5:2:1
link 5:2:14 4:3:1
link 1:4:21 5:3:1
#load the helix6-cut pdb which need to rotate 180 degree
load pdb na /usr/Namot/helix6-cut
set color m6:1:*:* orange
set color m5:1:*:* red
rotate 6 1 180
trans 6 16.89 -9.5 0
rotate 6 3 34
link 1:4:49 6:2:1
link 6:2:28 5:2:1
link 3:2:56 6:3:1
nick 6:2:10
#link the six helix-cut and the first helix-cut
link 1:4:63 1:5:1
link 4:2:70 6:2:1
link 3:2:70 1:2:1
link 4:3:63 6:3:1
write pdb hex6-dna.pdb